diff --git a/data/pre-processing_examples/Example_1.fastq.gz b/data/pre-processing_examples/Example_1.fastq.gz new file mode 100644 index 0000000000000000000000000000000000000000..523e940d016b964a6c0702d5c6539330baf47bf6 Binary files /dev/null and b/data/pre-processing_examples/Example_1.fastq.gz differ diff --git a/data/pre-processing_examples/Example_2.fastq.gz b/data/pre-processing_examples/Example_2.fastq.gz new file mode 100644 index 0000000000000000000000000000000000000000..369d336b213c5d3f2aa31cb97045c88231a54849 Binary files /dev/null and b/data/pre-processing_examples/Example_2.fastq.gz differ diff --git a/data/pre-processing_examples/Example_3.fastq.gz b/data/pre-processing_examples/Example_3.fastq.gz new file mode 100644 index 0000000000000000000000000000000000000000..6ae7215ae92c3d790e53a1948eb8c45bc3b6d45a Binary files /dev/null and b/data/pre-processing_examples/Example_3.fastq.gz differ diff --git a/scripts/Pre-processing.ipynb b/scripts/Pre-processing.ipynb new file mode 100644 index 0000000000000000000000000000000000000000..4556c74ce2115a19ab680dfe7e22a4b9c4bdd9dc --- /dev/null +++ b/scripts/Pre-processing.ipynb @@ -0,0 +1,882 @@ +{ + "cells": [ + { + "cell_type": "markdown", + "id": "a64ebf77-9027-4dfe-973b-36c2c721a491", + "metadata": {}, + "source": [ + "# Notebook on pre-processing functions (`parse_reads` or `demultiplex`) of 5'/3'-ends RNA-Seq data\n", + "\n", + "The 3 datasets required for this notebook are provided in the [data](../data) directory of the GitLab project.\n" + ] + }, + { + "cell_type": "markdown", + "id": "acf99143-ad96-4fbe-be2a-d0b3c6c3ab6a", + "metadata": {}, + "source": [ + "# Load the EMOTE-tk librarie from the Rsource file" + ] + }, + { + "cell_type": "code", + "execution_count": 1, + "id": "23c68491-3667-48a6-b38c-2a6092a1874a", + "metadata": { + "scrolled": true + }, + "outputs": [ + { + "name": "stderr", + "output_type": "stream", + "text": [ + "── Attaching core tidyverse packages ────────────────────────────────────────────────────────────────────────────────────────────────────── tidyverse 2.0.0 ──\n", + "✔ dplyr 1.1.4 ✔ readr 2.1.5\n", + "✔ forcats 1.0.0 ✔ stringr 1.5.1\n", + "✔ ggplot2 3.4.4 ✔ tibble 3.2.1\n", + "✔ lubridate 1.9.3 ✔ tidyr 1.3.0\n", + "✔ purrr 1.0.2 \n", + "── Conflicts ──────────────────────────────────────────────────────────────────────────────────────────────────────────────────────── tidyverse_conflicts() ──\n", + "✖ dplyr::filter() masks stats::filter()\n", + "✖ dplyr::lag() masks stats::lag()\n", + "ℹ Use the conflicted package (<http://conflicted.r-lib.org/>) to force all conflicts to become errors\n", + "Loading required package: GenomeInfoDb\n", + "\n", + "Loading required package: BiocGenerics\n", + "\n", + "\n", + "Attaching package: ‘BiocGenerics’\n", + "\n", + "\n", + "The following objects are masked from ‘package:lubridate’:\n", + "\n", + " intersect, setdiff, union\n", + "\n", + "\n", + "The following objects are masked from ‘package:dplyr’:\n", + "\n", + " combine, intersect, setdiff, union\n", + "\n", + "\n", + "The following objects are masked from ‘package:stats’:\n", + "\n", + " IQR, mad, sd, var, xtabs\n", + "\n", + "\n", + "The following objects are masked from ‘package:base’:\n", + "\n", + " anyDuplicated, aperm, append, as.data.frame, basename, cbind, colnames, dirname, do.call, duplicated, eval, evalq, Filter, Find, get, grep, grepl, intersect, is.unsorted, lapply, Map, mapply, match, mget, order, paste,\n", + " pmax, pmax.int, pmin, pmin.int, Position, rank, rbind, Reduce, rownames, sapply, setdiff, sort, table, tapply, union, unique, unsplit, which.max, which.min\n", + "\n", + "\n", + "Loading required package: S4Vectors\n", + "\n", + "Loading required package: stats4\n", + "\n", + "\n", + "Attaching package: ‘S4Vectors’\n", + "\n", + "\n", + "The following objects are masked from ‘package:lubridate’:\n", + "\n", + " second, second<-\n", + "\n", + "\n", + "The following objects are masked from ‘package:dplyr’:\n", + "\n", + " first, rename\n", + "\n", + "\n", + "The following object is masked from ‘package:tidyr’:\n", + "\n", + " expand\n", + "\n", + "\n", + "The following object is masked from ‘package:utils’:\n", + "\n", + " findMatches\n", + "\n", + "\n", + "The following objects are masked from ‘package:base’:\n", + "\n", + " expand.grid, I, unname\n", + "\n", + "\n", + "Loading required package: IRanges\n", + "\n", + "\n", + "Attaching package: ‘IRanges’\n", + "\n", + "\n", + "The following object is masked from ‘package:lubridate’:\n", + "\n", + " %within%\n", + "\n", + "\n", + "The following objects are masked from ‘package:dplyr’:\n", + "\n", + " collapse, desc, slice\n", + "\n", + "\n", + "The following object is masked from ‘package:purrr’:\n", + "\n", + " reduce\n", + "\n", + "\n", + "Loading required package: GenomicRanges\n", + "\n", + "Loading required package: Biostrings\n", + "\n", + "Loading required package: XVector\n", + "\n", + "\n", + "Attaching package: ‘XVector’\n", + "\n", + "\n", + "The following object is masked from ‘package:purrr’:\n", + "\n", + " compact\n", + "\n", + "\n", + "\n", + "Attaching package: ‘Biostrings’\n", + "\n", + "\n", + "The following object is masked from ‘package:base’:\n", + "\n", + " strsplit\n", + "\n", + "\n", + "Loading required package: BiocParallel\n", + "\n", + "Loading required package: GenomicAlignments\n", + "\n", + "Loading required package: SummarizedExperiment\n", + "\n", + "Loading required package: MatrixGenerics\n", + "\n", + "Loading required package: matrixStats\n", + "\n", + "\n", + "Attaching package: ‘matrixStats’\n", + "\n", + "\n", + "The following object is masked from ‘package:dplyr’:\n", + "\n", + " count\n", + "\n", + "\n", + "\n", + "Attaching package: ‘MatrixGenerics’\n", + "\n", + "\n", + "The following objects are masked from ‘package:matrixStats’:\n", + "\n", + " colAlls, colAnyNAs, colAnys, colAvgsPerRowSet, colCollapse, colCounts, colCummaxs, colCummins, colCumprods, colCumsums, colDiffs, colIQRDiffs, colIQRs, colLogSumExps, colMadDiffs, colMads, colMaxs, colMeans2, colMedians,\n", + " colMins, colOrderStats, colProds, colQuantiles, colRanges, colRanks, colSdDiffs, colSds, colSums2, colTabulates, colVarDiffs, colVars, colWeightedMads, colWeightedMeans, colWeightedMedians, colWeightedSds,\n", + " colWeightedVars, rowAlls, rowAnyNAs, rowAnys, rowAvgsPerColSet, rowCollapse, rowCounts, rowCummaxs, rowCummins, rowCumprods, rowCumsums, rowDiffs, rowIQRDiffs, rowIQRs, rowLogSumExps, rowMadDiffs, rowMads, rowMaxs,\n", + " rowMeans2, rowMedians, rowMins, rowOrderStats, rowProds, rowQuantiles, rowRanges, rowRanks, rowSdDiffs, rowSds, rowSums2, rowTabulates, rowVarDiffs, rowVars, rowWeightedMads, rowWeightedMeans, rowWeightedMedians,\n", + " rowWeightedSds, rowWeightedVars\n", + "\n", + "\n", + "Loading required package: Biobase\n", + "\n", + "Welcome to Bioconductor\n", + "\n", + " Vignettes contain introductory material; view with 'browseVignettes()'. To cite Bioconductor, see 'citation(\"Biobase\")', and for packages 'citation(\"pkgname\")'.\n", + "\n", + "\n", + "\n", + "Attaching package: ‘Biobase’\n", + "\n", + "\n", + "The following object is masked from ‘package:MatrixGenerics’:\n", + "\n", + " rowMedians\n", + "\n", + "\n", + "The following objects are masked from ‘package:matrixStats’:\n", + "\n", + " anyMissing, rowMedians\n", + "\n", + "\n", + "\n", + "Attaching package: ‘GenomicAlignments’\n", + "\n", + "\n", + "The following object is masked from ‘package:dplyr’:\n", + "\n", + " last\n", + "\n", + "\n", + "\n", + "Attaching package: ‘ShortRead’\n", + "\n", + "\n", + "The following object is masked from ‘package:dplyr’:\n", + "\n", + " id\n", + "\n", + "\n", + "The following object is masked from ‘package:purrr’:\n", + "\n", + " compose\n", + "\n", + "\n", + "The following object is masked from ‘package:tibble’:\n", + "\n", + " view\n", + "\n", + "\n", + "Loading required package: splines\n", + "\n", + "Loading required package: survival\n", + "\n", + "Loading required package: prodlim\n", + "\n", + "\n", + "Attaching package: ‘survcomp’\n", + "\n", + "\n", + "The following object is masked from ‘package:VGAM’:\n", + "\n", + " fisherz\n", + "\n", + "\n", + "Loading required package: bsseq\n", + "\n" + ] + } + ], + "source": [ + "options(width = 250)\n", + "options(crayon.enabled = FALSE)\n", + "source(\"../src/emote-tk.R\")" + ] + }, + { + "cell_type": "markdown", + "id": "8a139229-5f41-48ba-9408-fe5417e9ab16", + "metadata": {}, + "source": [ + "# Extraction of the mappable part of reads" + ] + }, + { + "cell_type": "markdown", + "id": "7d8d915b-6d84-4099-8085-74661a0966d7", + "metadata": {}, + "source": [ + "Let's have a look on raw reads we want to parse:" + ] + }, + { + "cell_type": "code", + "execution_count": 2, + "id": "e28fdd55-ad64-456f-80a6-155be69b6fbd", + "metadata": {}, + "outputs": [ + { + "data": { + "text/plain": [ + "DNAStringSet object of length 10000:\n", + " width seq\n", + " [1] 33 AGGAGAAGAGCGGTTCAGCAGGAATGCCGAGAC\n", + " [2] 33 AGGAAGAGCGGTTCAGCAGGAATGCCGAGACCG\n", + " [3] 33 AGGCCAGCGACGCGAAGTAGAATCAGTAATTTG\n", + " [4] 33 AGGCAAGGAACGCCATGCGAGAGCGGTATTATC\n", + " [5] 33 AGGGGTTAAGTTATTAAGGGCGCACGGTGGATG\n", + " ... ... ...\n", + " [9996] 33 AGGGCAAAAACGCGCACAAAAAATGACCAAGAA\n", + " [9997] 33 AGGAGGGACAGCACCGCTCTTCCGATCTTAAGC\n", + " [9998] 33 AGGGTCCCCCGCTTATTGATATGCAAGATGAAG\n", + " [9999] 33 AGGCGAGGCACGCTCAGTCAAGCTGATTTAAAT\n", + "[10000] 33 AGGGGGCGCGCGCTAAAAGCTACGCACGTTTTT" + ] + }, + "metadata": {}, + "output_type": "display_data" + } + ], + "source": [ + "fq_streamer = FastqStreamer(\"../data/pre-processing_examples/Example_1.fastq.gz\")\n", + "sr <- yield(fq_streamer)\n", + "sr@sread" + ] + }, + { + "cell_type": "markdown", + "id": "282ab09c-fcc3-4f58-acc4-d90dc87f9c6d", + "metadata": {}, + "source": [ + "For this example we have 10000 reads that are 33 nucleotides long that should be built that way:\n", + "<pre> \n", + " 1 3 4 10 11 13 14 33\n", + " AGG - VVVVVVV - CGC - XXXXXXXXXXXXXXXXXXXXX\n", + "recognition.seq - UMI - control.seq - RNA 5'-end (readseq)\n", + "</pre>\n", + "\n", + "- The 3 first nucleotides correspond to a **recognition.sequence** which should always be `AGG`\n", + "- The 7 next nucleotides are a random sequence constituting a Unique Molecule Identifier (**UMI**) where the only constraint is that it must not contain any T\n", + "- Then it should be an exact sequence again (**control.seq**) that correspond to `CGC`\n", + "- Finally, we have the **5'-end of the transcript**\n", + "\n", + "In order to extract only the part that correspond to the 5'-end of the transcript, we have to fill an `EMOTE_features` table using the `EMOTE_read_features` function." + ] + }, + { + "cell_type": "code", + "execution_count": 3, + "id": "c1bf29b6-53ca-4861-ac8c-4937203e0bd0", + "metadata": {}, + "outputs": [], + "source": [ + "rf = EMOTE_read_features(start = 14, width = 19)" + ] + }, + { + "cell_type": "markdown", + "id": "ccf3cd26-68b7-4f61-9a9e-61fa19504dad", + "metadata": {}, + "source": [ + "By default, only A, C, T or G are allowed in the nucleotides sequence. It is possible to change the number of mismatch allowed as well as the allowed nucleotides/characters of the `readseq` sequence by modifiying some parameters as follows:" + ] + }, + { + "cell_type": "code", + "execution_count": 4, + "id": "c2c6d370-dd19-47d0-9bdc-7e168d1d8c34", + "metadata": {}, + "outputs": [ + { + "data": { + "text/html": [ + "<table class=\"dataframe\">\n", + "<caption>A EMOTE_features: 1 × 7</caption>\n", + "<thead>\n", + "\t<tr><th scope=col>name</th><th scope=col>start</th><th scope=col>width</th><th scope=col>pattern_type</th><th scope=col>pattern</th><th scope=col>max_mismatch</th><th scope=col>readid_prepend</th></tr>\n", + "\t<tr><th scope=col><chr></th><th scope=col><dbl></th><th scope=col><dbl></th><th scope=col><dbl></th><th scope=col><chr></th><th scope=col><dbl></th><th scope=col><lgl></th></tr>\n", + "</thead>\n", + "<tbody>\n", + "\t<tr><td>readseq</td><td>14</td><td>19</td><td>1</td><td>ACG</td><td>1</td><td>FALSE</td></tr>\n", + "</tbody>\n", + "</table>\n" + ], + "text/latex": [ + "A EMOTE\\_features: 1 × 7\n", + "\\begin{tabular}{lllllll}\n", + " name & start & width & pattern\\_type & pattern & max\\_mismatch & readid\\_prepend\\\\\n", + " <chr> & <dbl> & <dbl> & <dbl> & <chr> & <dbl> & <lgl>\\\\\n", + "\\hline\n", + "\t readseq & 14 & 19 & 1 & ACG & 1 & FALSE\\\\\n", + "\\end{tabular}\n" + ], + "text/markdown": [ + "\n", + "A EMOTE_features: 1 × 7\n", + "\n", + "| name <chr> | start <dbl> | width <dbl> | pattern_type <dbl> | pattern <chr> | max_mismatch <dbl> | readid_prepend <lgl> |\n", + "|---|---|---|---|---|---|---|\n", + "| readseq | 14 | 19 | 1 | ACG | 1 | FALSE |\n", + "\n" + ], + "text/plain": [ + " name start width pattern_type pattern max_mismatch readid_prepend\n", + "1 readseq 14 19 1 ACG 1 FALSE " + ] + }, + "metadata": {}, + "output_type": "display_data" + } + ], + "source": [ + "EMOTE_read_features(start = 14, width = 19, pattern = \"ACG\", max_mismatch = 1)" + ] + }, + { + "cell_type": "code", + "execution_count": 5, + "id": "84ce999b-a51f-4dc7-b518-4468fe0fdb85", + "metadata": {}, + "outputs": [ + { + "ename": "ERROR", + "evalue": "Error in `mutate()`:\nℹ In argument: `pc_valid = is_valid/total_read`.\nCaused by error:\n! object 'is_valid' not found\n", + "output_type": "error", + "traceback": [ + "Error in `mutate()`:\nℹ In argument: `pc_valid = is_valid/total_read`.\nCaused by error:\n! object 'is_valid' not found\nTraceback:\n", + "1. EMOTE_parse_read(fastq_file = \"../data/pre-processing_examples/Example_1.fastq.gz\", \n . features = rf, force = T)", + "2. mutate(stat_tb, pc_valid = is_valid/total_read) %>% mutate(demux_filename = paste0(out_dir, \n . \"/\", fq_basename, \"_\", tolower(group), \".fastq.gz\"))", + "3. mutate(., demux_filename = paste0(out_dir, \"/\", fq_basename, \n . \"_\", tolower(group), \".fastq.gz\"))", + "4. mutate(stat_tb, pc_valid = is_valid/total_read)", + "5. mutate.data.frame(stat_tb, pc_valid = is_valid/total_read)", + "6. mutate_cols(.data, dplyr_quosures(...), by)", + "7. withCallingHandlers(for (i in seq_along(dots)) {\n . poke_error_context(dots, i, mask = mask)\n . context_poke(\"column\", old_current_column)\n . new_columns <- mutate_col(dots[[i]], data, mask, new_columns)\n . }, error = dplyr_error_handler(dots = dots, mask = mask, bullets = mutate_bullets, \n . error_call = error_call, error_class = \"dplyr:::mutate_error\"), \n . warning = dplyr_warning_handler(state = warnings_state, mask = mask, \n . error_call = error_call))", + "8. mutate_col(dots[[i]], data, mask, new_columns)", + "9. mask$eval_all_mutate(quo)", + "10. eval()", + "11. .handleSimpleError(function (cnd) \n . {\n . local_error_context(dots, i = frame[[i_sym]], mask = mask)\n . if (inherits(cnd, \"dplyr:::internal_error\")) {\n . parent <- error_cnd(message = bullets(cnd))\n . }\n . else {\n . parent <- cnd\n . }\n . message <- c(cnd_bullet_header(action), i = if (has_active_group_context(mask)) cnd_bullet_cur_group_label())\n . abort(message, class = error_class, parent = parent, call = error_call)\n . }, \"object 'is_valid' not found\", base::quote(NULL))", + "12. h(simpleError(msg, call))", + "13. abort(message, class = error_class, parent = parent, call = error_call)", + "14. signal_abort(cnd, .file)" + ] + } + ], + "source": [ + "EMOTE_parse_read(\n", + " fastq_file = \"../data/pre-processing_examples/Example_1.fastq.gz\",\n", + " features = rf,\n", + " force = T)" + ] + }, + { + "cell_type": "code", + "execution_count": null, + "id": "9bb4d784-8ae4-49a8-b648-8972a19f1e12", + "metadata": {}, + "outputs": [], + "source": [ + "fq_streamer = FastqStreamer(\"../data/pre-processing_examples/Example_1_valid.fastq.gz\")\n", + "sr <- yield(fq_streamer)\n", + "sr@sread" + ] + }, + { + "cell_type": "markdown", + "id": "2bdc6812-0684-4767-bb95-cacfa31e252f", + "metadata": {}, + "source": [ + "We see that only the sequence from position 14 to 33 are present in the out fastq file" + ] + }, + { + "cell_type": "markdown", + "id": "00392ee1-4176-4ccb-8de3-5345bd6c3d98", + "metadata": {}, + "source": [ + "# Extraction of the mappable part of **valid** reads" + ] + }, + { + "cell_type": "markdown", + "id": "9374d0b8-e3ac-4732-936b-e47f7d55a7d1", + "metadata": {}, + "source": [ + "In addition to what we have done before we can extract the 5'-ends of the transcripts only for the reads which are valid by testing the validity of each expected elements we described earlier. <br>\n", + "To do that let's add some feature to our EMOTE_features table with the **EMOTE_add_read_feature** function:" + ] + }, + { + "cell_type": "code", + "execution_count": null, + "id": "b13d7122-84f3-4ca4-a17f-0c6cb79ca173", + "metadata": {}, + "outputs": [], + "source": [ + "rf = EMOTE_add_read_feature(rf, name = \"Recognition.seq\", start = 1, width = 3, pattern = \"AGG\" , pattern_type = 2)\n", + "rf = EMOTE_add_read_feature(rf, name = \"Control.seq\", start = 11, width = 3, pattern = \"CGC\", pattern_type = 2)" + ] + }, + { + "cell_type": "code", + "execution_count": null, + "id": "a54f7041-4a64-498e-8a0b-112aa5806b68", + "metadata": {}, + "outputs": [], + "source": [ + "rf" + ] + }, + { + "cell_type": "markdown", + "id": "5aee3e6d-672c-4a4a-9ff6-6d4f64276f7b", + "metadata": {}, + "source": [ + "Following the read structure we described, we define the start and the width and the expected sequence of the 2 features **Recognition.seq** and **control.seq**.\n", + "As these features should have an **exact** sequence at the given positions we set the pattern_type parameters = 2 <br>\n", + "In fact the pattern_type parameters can have 3 values:\n", + "- **1** if the pattern is a string of allowed characters\n", + "- **2** if the pattern is an exact sequence (or a vector of exact sequence)\n", + "- **3** if the pattern is a regular expression which, once spotted, is trimmed with whatever is behind it." + ] + }, + { + "cell_type": "markdown", + "id": "0a6affb9-4f5a-42eb-a014-1fdb2064d68b", + "metadata": {}, + "source": [ + "Then we will add the last feature we want to check which is the **UMI**:" + ] + }, + { + "cell_type": "code", + "execution_count": null, + "id": "6000958d-e2c8-437a-896a-7ddf9bcd3bf9", + "metadata": {}, + "outputs": [], + "source": [ + "rf = EMOTE_add_read_feature(rf, name = \"UMI\", start = 4, width = 7, pattern = \"ACG\", pattern_type = 1, readid_prepend = T)\n", + "\n", + "rf" + ] + }, + { + "cell_type": "markdown", + "id": "b7b009b5-6bed-4b19-b7f8-56bd439b7be9", + "metadata": {}, + "source": [ + "As for other features we set the name, start and width of the feature. <br>\n", + "As this feature is a random sequence with a list of allowed characters (A, C or G but not T) we set the pattern_type to 1 and the pattern to \"ACG\"\n", + "\n", + "We also set the **readid_prepend** to TRUE in order to put the identified UMI in the read identifier (we will check this later)" + ] + }, + { + "cell_type": "markdown", + "id": "ed26d4f1-1ab5-4c8d-97ce-9c1d004981dc", + "metadata": {}, + "source": [ + "Now we define all feature we expected to found along the reads we can (like the previous example), run the **EMOTE_parse_read** function to exact the readseq sequence of read that have all the feature valid" + ] + }, + { + "cell_type": "code", + "execution_count": null, + "id": "3b8ccb4d-98ad-487f-b577-37a09749f5ea", + "metadata": {}, + "outputs": [], + "source": [ + "report = EMOTE_parse_read(\n", + " fastq_file = \"../data/pre-processing_examples/Example_1.fastq.gz\",\n", + " features = rf,\n", + " force = T)\n", + "report" + ] + }, + { + "cell_type": "markdown", + "id": "13ebb809-7fbf-42b4-95a9-a3caffd57fe5", + "metadata": {}, + "source": [ + "The **EMOTE_parse_read function** return a parse report that provide some statistics about the validity of the checked feature. <br>\n", + "For example here, we see that among the 10000 input reads, 4820 were fully valid while 5163 were invalid due to an invalid feature. <br>\n", + "We also see that most of the invalid reads have a valid **Recognition.seq** and a valid **UMI** but very few reads have a valid **control.seq** indicating that the main reason for the invalidness of reads is due to the invalidity of the control.seq." + ] + }, + { + "cell_type": "markdown", + "id": "9347cb6f-24c7-49e1-9f7d-b915d6c18efd", + "metadata": {}, + "source": [ + "Let's have a look to out fastq to see if we only have the part of the read that correspond to the readseq sequence:" + ] + }, + { + "cell_type": "code", + "execution_count": null, + "id": "a42ea938-09f8-49cb-946d-eaeb53de509a", + "metadata": {}, + "outputs": [], + "source": [ + "fq_streamer = FastqStreamer(\"../data/pre-processing_examples/Example_1_valid.fastq.gz\")\n", + "sr <- yield(fq_streamer)\n", + "sr@sread" + ] + }, + { + "cell_type": "markdown", + "id": "c0d7a261-b1cb-4348-93ca-3fc60cceb841", + "metadata": {}, + "source": [ + "Let's have also a look if the UMI sequence have correctly been put in the read identifiers" + ] + }, + { + "cell_type": "code", + "execution_count": null, + "id": "a8ae5dcd-3eef-4c81-8d09-2520d9c0b8ad", + "metadata": {}, + "outputs": [], + "source": [ + "sr@id" + ] + }, + { + "cell_type": "markdown", + "id": "fe4f9f6d-e1af-46a9-8bb7-f5d9aa820125", + "metadata": {}, + "source": [ + "# Extraction of the mappable part of reads according to a barcode sequence" + ] + }, + { + "cell_type": "markdown", + "id": "3265cfdf-4ae8-4605-8cbb-71c1fd56f418", + "metadata": {}, + "source": [ + "In order to multiplex multiple experimental conditions into one sequencing run, it is possible to ligate a barcode sequence to the ends of the transcript.\n", + "For this example we have 10000 reads that are 24 nucleotides long that should be built that way:\n", + "<pre> \n", + " 1 4 5 24\n", + " CAAG/TCGG - XXXXXXXXXXXXXXXXXXXX\n", + " barcode - RNA 5'-end (readseq)\n", + "</pre>\n", + "\n", + "- The 4 first nucleotide correspond to a **barcode sequence** which should always be either \"CAAG\" or \"TCGG\"\n", + "- Then we have the **5'-end of the transcript**" + ] + }, + { + "cell_type": "code", + "execution_count": null, + "id": "ccf94585-eff7-4fc6-b781-f4e461309d75", + "metadata": {}, + "outputs": [], + "source": [ + "fq_streamer = FastqStreamer(\"../data/pre-processing_examples/Example_2.fastq.gz\")\n", + "sr <- yield(fq_streamer)\n", + "sr@sread" + ] + }, + { + "cell_type": "markdown", + "id": "5bee9dd0-0ae7-45f2-a118-0e8e04f860d4", + "metadata": {}, + "source": [ + "Let's build the EMOTE_features table in order to extact the mappable part of reads and regroup them into different output fastq file according to the barcode sequence.\n", + "\n", + "We being the mappable part (the 5'-end of RNA), the add the barcode feature as follow:" + ] + }, + { + "cell_type": "code", + "execution_count": null, + "id": "d644a577-2a85-4470-b7a2-1a16b200bd37", + "metadata": {}, + "outputs": [], + "source": [ + "rf = EMOTE_read_features(start = 5, width = 20)\n", + "rf = EMOTE_add_read_feature(rf, name = \"barcode\", start = 1, width = 4, pattern = c(\"TCGG\",\"CAAG\") , pattern_type = 2, readid_prepend = F)\n", + "\n", + "rf" + ] + }, + { + "cell_type": "markdown", + "id": "b0fc19bc-37d4-4028-9c76-4de2e1bcb23a", + "metadata": {}, + "source": [ + "Nota that it is **mandatory** to name the feature you want to use for demultiplexing: \"barcode\" <br>\n", + "- start position and the width are set according to the read structure we defined. <br>\n", + "- the pattern parameters is a vector containing the 2 allowed barcode sequences (\"TCGG\" and \"CAAG\"). <br>\n", + "- The pattern_type is set to 2 because the pattern correspond to exact sequences" + ] + }, + { + "cell_type": "markdown", + "id": "2489d2f0-c967-4881-aff3-5954ef132b76", + "metadata": {}, + "source": [ + "Now we have the EMOTE_feature table, we can extract the mappable part of reads which have a valid barcode sequence and split them into different output fastq file according to the feature named \"barcode\" using the **EMOTE_demultiplex** function:" + ] + }, + { + "cell_type": "code", + "execution_count": null, + "id": "0d9359ed-ae1c-4e2d-b005-eaf269b446b8", + "metadata": {}, + "outputs": [], + "source": [ + "EMOTE_demultiplex(\n", + " fastq_file = \"../data/pre-processing_examples/Example_2.fastq.gz\",\n", + " features = rf\n", + ")" + ] + }, + { + "cell_type": "markdown", + "id": "328486dd-8f0e-4e45-998a-db92391a0641", + "metadata": {}, + "source": [ + "**EMOTE_demultiplex** also return a report with statistics about the validity of features. <br>\n", + "These stats are regrouped by barcode\n", + "\n", + "**Explication table ?**" + ] + }, + { + "cell_type": "markdown", + "id": "bb194c43-4b5e-4356-a3f0-4e599b3f9a60", + "metadata": {}, + "source": [ + "Once again if we take a look to one of the two output file we see that we only kept the part we wanted to extract." + ] + }, + { + "cell_type": "code", + "execution_count": null, + "id": "cb6ab678-8bb7-4ef4-9168-1a6988bcc1f8", + "metadata": {}, + "outputs": [], + "source": [ + "fq_streamer = FastqStreamer(\"../data/pre-processing_examples/Example_2_demux/Example_2_TCGG_valid.fastq.gz\")\n", + "sr <- yield(fq_streamer)\n", + "sr@sread" + ] + }, + { + "cell_type": "markdown", + "id": "009b2b76-0ab0-49fc-b95d-063fe1420655", + "metadata": {}, + "source": [ + "# Removing of a pattern from the mappable part of reads" + ] + }, + { + "cell_type": "markdown", + "id": "6754034a-1427-4e56-bcf0-8677822016cf", + "metadata": {}, + "source": [ + "For this example, we have 10000 reads that have no specific structure but due to a step during the experimental protocol, reads can have a poly A sequence that should be removed in order to map on the reference genome" + ] + }, + { + "cell_type": "code", + "execution_count": null, + "id": "6c933c7e-0124-48d9-a4e9-11a9778da695", + "metadata": {}, + "outputs": [], + "source": [ + "fq_streamer = FastqStreamer(\"../data/pre-processing_examples/Example_3.fastq.gz\")\n", + "sr <- yield(fq_streamer)\n", + "sr@sread" + ] + }, + { + "cell_type": "markdown", + "id": "92e35290-5bc6-4125-a3cc-4ad2cd2e2ef8", + "metadata": {}, + "source": [ + "We see that several reads have a succession of A that can't map on a genome. <br>\n", + "So let's parse them in order to remove these poly A sequences using **EMOTE_parse_read** but in a first instance we have to build an **EMOTE_features table**: " + ] + }, + { + "cell_type": "code", + "execution_count": null, + "id": "bd2100af-f92d-4cb6-8199-6c4b945bb434", + "metadata": {}, + "outputs": [], + "source": [ + "rf = EMOTE_read_features(start = 1, width = 50)" + ] + }, + { + "cell_type": "markdown", + "id": "e1106b6d-c1df-444f-a498-47329849e753", + "metadata": {}, + "source": [ + "This time, the positions of the sequence to extract is variable since the positions of poly A are also variables. <br>\n", + "So we set the start position to 1 and the width to 50 (the entire read sequence), and the extraction of the mappable part will be done after the removal of the poly A." + ] + }, + { + "cell_type": "markdown", + "id": "efe14dc6-1219-4a88-8d6f-2ec1e3a07cec", + "metadata": {}, + "source": [ + "Now let's add the poly A feature to our EMOTE_features table:" + ] + }, + { + "cell_type": "code", + "execution_count": null, + "id": "233819ea-b139-4950-a735-8800952aa769", + "metadata": {}, + "outputs": [], + "source": [ + "rf = EMOTE_add_read_feature(rf, name = \"PolyA\",start = 1,width = 50, pattern = \"AAAAAA.+\" , pattern_type = 3, readid_prepend = F)\n", + "rf" + ] + }, + { + "cell_type": "markdown", + "id": "1d4d080c-1bec-490d-b8f9-7b00891ad48f", + "metadata": {}, + "source": [ + "As the poly A sequence can be found anywhere on the reads we set the start position to 1 and the width to 50. <br>\n", + "The pattern corresponds to a regular expression, here define a poly A as a succession of minimum 6 A. <br>\n", + "The pattern being a regular expression to identity and remove with whatever is behind it, we set the pattern_type to 3 " + ] + }, + { + "cell_type": "markdown", + "id": "e25ca83a-36a5-4441-96c7-7c6fd9757220", + "metadata": {}, + "source": [ + "With this EMOTE_features table we can perform an **EMOTE_parse_read**" + ] + }, + { + "cell_type": "code", + "execution_count": null, + "id": "3377e5b5-be74-481c-bfa5-96e5b63d608e", + "metadata": {}, + "outputs": [], + "source": [ + "report = EMOTE_parse_read(\n", + " fastq_file = \"../data/pre-processing_examples/Example_3.fastq.gz\",\n", + " features = rf,\n", + " force = T)\n", + "report" + ] + }, + { + "cell_type": "markdown", + "id": "56cb8e86-5ff9-4175-9dc2-3b7b34b20d2c", + "metadata": {}, + "source": [ + "The report indicated that among the 10000 reads, only 8212 were valids due to the validty of readseq. <br>\n", + "Note that the invalidy of readseq may also be due to too short read after the removal of the poly A." + ] + }, + { + "cell_type": "code", + "execution_count": null, + "id": "3ce07100-5c95-47fe-a7e3-d71729e854b3", + "metadata": {}, + "outputs": [], + "source": [ + "fq_streamer = FastqStreamer(\"../data/pre-processing_examples/Example_3_valid.fastq.gz\")\n", + "sr <- yield(fq_streamer)\n", + "sr@sread" + ] + }, + { + "cell_type": "markdown", + "id": "5f6e1198-aea7-44c2-ab11-b7fa3cd88793", + "metadata": {}, + "source": [ + "As we can see, Poly A are removed from the reads, generating reads of different lengths. <br>\n", + "It is possible to set a minimal length allowed in the **EMOTE_parse_read** function (default is 18)" + ] + } + ], + "metadata": { + "kernelspec": { + "display_name": "R [conda env:emote-tk-devel-shared-env-R4.3.2] *", + "language": "R", + "name": "conda-env-emote-tk-devel-shared-env-R4.3.2-r" + }, + "language_info": { + "codemirror_mode": "r", + "file_extension": ".r", + "mimetype": "text/x-r-source", + "name": "R", + "pygments_lexer": "r", + "version": "4.3.2" + } + }, + "nbformat": 4, + "nbformat_minor": 5 +}